Journal: iScience

Article Title: Fumarase affects the deoxyribonucleic acid damage response by protecting the mitochondrial desulfurase Nfs1p from modification and inactivation

doi: 10.1016/j.isci.2021.103354

Figure Lengend Snippet: Overexpression of Nfs1p restores DNA repair in cells lacking fumarase (A) Overexpression of Nfs1p from the multi-copy vector YEp13 under the control of its own promoter restored growth of diploid BY4743ΔWΔfum1 cells on plates containing 360mM HU: Cells of the indicated genotype were 10-fold serially diluted, spotted onto the depicted plates, and incubated for 12 days at 28°C. (B) Restoration of DNA repair requires mitochondrial localization of Nfs1p: Overexpression of Nfs1p, but not Nfs1p lacking its mitochondrial targeting signal MTS, from the multi-copy vector PADNX under the control of the strong ADH1 promoter restored growth of haploid BY4742ΔWΔfum1 cells on plates containing 300mM HU. Cells of the indicated genotype were 10-fold serially diluted, spotted onto the depicted plates, and incubated for six days at 28°C. (C) Cytosolic Fum1p interacts with cytosolic Nfs1p in the split-Ub assay in vivo: Cells of the indicated genotype were 10-fold serially diluted, spotted onto the depicted plates, and incubated for six days at 28°C. Nub-Fum1ΔMTSp was expressed from the ADH1 promoter, while Nub-Nfs1ΔMTS was expressed from the NFS1 promoter. Fum1ΔMTS-Cub-RUra3p was expressed from the FUM1 promoter and Nfs1ΔMTS-Cub-RUra3p was expressed from the NFS1 promoter. The protein–protein interaction between Fum1p and Nfs1p in the cytosol is indicated by the absence of growth on the plate lacking uracil. (D) Fumarase interacts with Nfs1p in a GST pull-down assay in vitro: GST and GST-Nfs1ΔMTSp were purified with glutathione beads in the presence of H 6 -HA-Fum1ΔMTSp. Co-precipitated H 6 -HA-Fum1ΔMTSp was detected with an anti-HA antibody.

Article Snippet: Multi-copy library of Saccharomyces cerevisiae genomic DNA fragments in YEp13 , ATCC , Cat#37323.

Techniques: Over Expression, Plasmid Preparation, Control, Incubation, In Vivo, Pull Down Assay, In Vitro, Purification

Journal: iScience

Article Title: Fumarase affects the deoxyribonucleic acid damage response by protecting the mitochondrial desulfurase Nfs1p from modification and inactivation

doi: 10.1016/j.isci.2021.103354

Figure Lengend Snippet: Nfs1S491 and I492 are required for the protein interaction of Nfs1p with Isu1/2p (A) Overexpression of Isu1/2p from the multi-copy vector YEp13 under the control of their own respective promoters restores DNA repair in nfs1S491P and I492T : Cells of the indicated genotype were 10-fold serially diluted, spotted onto the depicted plates, and incubated for 12 days at 28°C. (B) Restoration of DNA repair requires mitochondrial localization of Isu1/2p: Overexpression of Isu1/2p, but not Isu1/2p lacking the mitochondrial targeting signal MTS, from the multi-copy vector PADNX under the control of the strong ADH1 promoter restored growth of nfs1S491 and nfs1I492T on plates containing 300mM HU: Cells of the indicated genotype were 10-fold serially diluted, spotted onto the depicted plates, and incubated for six days at 28°C. (C) Nfs1S491 and I492 are required for the protein interaction of Nfs1p with Isu1p: Cells of the indicated genotype were 10-fold serially diluted, spotted onto the depicted plates, and incubated for six days at 28°C. Nub-Nfs1ΔMTSp was expressed from the NFS1 promoter and Isu1ΔMTS-CubRUra3p was expressed from the CUP1 promoter. Protein interaction between Nfs1p and Isu1p is revealed by the lack of growth on the plates lacking uracil.

Article Snippet: Multi-copy library of Saccharomyces cerevisiae genomic DNA fragments in YEp13 , ATCC , Cat#37323.

Techniques: Over Expression, Plasmid Preparation, Control, Incubation

Journal: iScience

Article Title: Fumarase affects the deoxyribonucleic acid damage response by protecting the mitochondrial desulfurase Nfs1p from modification and inactivation

doi: 10.1016/j.isci.2021.103354

Figure Lengend Snippet:

Article Snippet: Multi-copy library of Saccharomyces cerevisiae genomic DNA fragments in YEp13 , ATCC , Cat#37323.

Techniques: Virus, Recombinant, Generated, Molecular Cloning, Software

Journal: Cold Spring Harbor protocols

Article Title: Hi-C in Budding Yeast.

doi: 10.1101/pdb.prot085209

Figure Lengend Snippet: FIGURE 1. Schematic overview of the Hi-C procedure and quality control. (A). Hi-C is based on 3C, in which the chromatin is cross-linked using formaldehyde and digested with a restriction enzyme (see Protocol: Chromosome Conformation Capture (3C) in Budding Yeast [Belton and Dekker 2015]). Hi-C is unique in that the overhangs of the restriction cut site are filled in with a biotinylated nucleotide before ligation. Intra-molecular ligation and purification are very similar to the 3C protocol; however, the Hi-C method contains a few additional steps to enrich for ligation products. First, biotin incorporated into free ends (not at a ligation junction of two different fragments) is removed using the exonuclease activity of T4 DNA polymerase. The library is then fragmented by sonication and true ligation products are enriched by pull-down using streptavidin-coated beads. (B) The purified Hi-C library runs at ≏12 kb on a 0.8% agarose gel (Step 65), indicated by the arrow. M, 1-kb DNA ladder. (C) Agarose gel for estimation of Hi-C efficiency (Step 68). H, HindIII digested; N, NheI digested; B, both HindIII and NheI digested; 0, no digestion of the PCR product; M, low molecular mass marker. The upper arrow indicates the undigested PCR product and the two lower arrows indicate the digestion products. (D) Electrophoresis of PCR cycle titration (Step 110). M, low molecular mass marker; “6,” “9,” “12,” “15,” “18” are the number of cycles used to amplify the library. The bottom arrow indicates the correct size of the Hi-C library and the upper arrow indicates high-molecular-mass species that arise from overamplifying the library.

Article Snippet: ATP (100 mM) Binding buffer (BB) (1× and 2×) Bovine serum albumin (BSA) (10 mg/mL) Buffer EB, prewarmed to 65 ̊C (QIAgen 19086) DNA polymerase I, large (Klenow) fragment (5 U/μL) (New England Biolabs M0210S) DNA quantification reagents for the method of choice (e.g., Bioanalyzer, qPCR, or fluorometry) Dynabeads MyOne Streptavidin C1 beads (Life Technologies 65001) Ethanol (100% and 70%) Formaldehyde (37%) (Fisher Scientific BP531-500) 1Correspondence: job.dekker@umassmed.edu © 2015 Cold Spring Harbor Laboratory Press Cite this protocol as Cold Spring Harb Protoc; doi:10.1101/pdb.prot085209 649 Glycine (2.5 M, filter-sterilized) Klenow Fragment (3' 5' exo-) (5 U/μL) (New England Biolabs M0212S) Ligation buffer for 3C (10×) NEBuffer 2 (New England Biolabs B7002S) (10× and 1×) Nucleotides Biotin-14-dCTP (0.4 mM) (Life Technologies 19518-018) dATP (100 mM and 1 mM) dGTP (100 mM) dTTP (100 mM) Nucleotide (dNTP) mix (25 mM per nucleotide; 100 mM total) Nucleotide (dNTP) mix (1.25 mM per nucleotide; 5 mM total) Oligonucleotide primers Hi5: GTTTCCGAAAATCCACGACGAACCAG (80 μM) Hi6: ATATTTTCGCCGGAGGTGCTGGAAAT (80 μM) PE1.0: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT (HPLC-purified) (25 μM) PE2.0: CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCTTCC GATCT (HPLC-purified) (25 μM) Paired-end adapters compatible with the Illumina HiSeq or GAII platforms (available from Illumina, Kapa Biosystems, or Bioo Scientific) PfuUltra II Fusion HS polymerase with 10× reaction buffer (Agilent Technologies 600850) Phase Lock Gel Light tubes (15-mL) (5-Prime 2302840) Phase Lock Gel Light tubes (50-mL) (5-Prime 2302860) Phenol:chloroform (1:1) Proteinase K (Life Technologies 25530-015) Prepare a solution of 10 mg/mL in TE buffer .

Techniques: Hi-C, Control, Ligation, Purification, Activity Assay, Sonication, Agarose Gel Electrophoresis, Marker, Electrophoresis, Titration